Last data update: 17 January 2021 04:22 CET
Plasmid name: pSV51 (LMBP 1829)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p1829.gb
(View with Genome Compiler) p1829.txt p1829.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | - |
Promoter: | Simian virus 40 early promoter (SV40 early) Simian virus 40 late promoter (SV40 late) |
Ribosome binding site: |
- |
Terminator: | Phage fd terminator Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli; preferably recombination-deficient strains Mammalian cells; SV40 permissive cells |
Parental clone: | pSV529; pPLc2833FdT1 |
Further information: | This plasmid was derived from pSV529 by inserting the BamHI fragment of pPLc2833FdT1, containing the lac operator and the fd terminator, in the unique BamHI site; in fact, this fragment was inserted twice in the same orientation. SV40 DNA information starts at the HpaII site which was fused to the ClaI site of pBR322. This plasmid is a basic vector for gene expression under control of the SV40 late promoter (requires permissive cells, i.e. AGMK derivatives). An intron is excised from the 5' UTR of the major SV40 late transcripts. The most important transcription initiation site is located at nucleotide position 4838 (cfr. L325 in SV40). The transcription termination/polyadenylation site of SV40 is used. The SV40 late transcripts have multiple cap sites. The first early region of this vector, coding for the large T-antigen, is intact, so that the plasmid can replicate in all SV40 permissive cells. Expressing the large T-antigen, the plasmid is useful for the immortalization of mouse embryonic fibroblasts (MEF) and of human fibroblasts. Since 39% of the SV40 genome is duplicated (early region), one should be aware of the possibility of deletions due to homologous recombination. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727592.1. Other name of the plasmid is pSV5291. |
EMBL Accession number: | LT727592.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 04/04/1989 |
Sequence detail: | Nucleotide sequence of the inserted BamHI fragment: 5' GGATCCGGCTCTAGAGGGTCGACCCTCTAGAGG ... lac operator ... fd terminator ... BamHI XbaI SalI XbaI TCTAGAGGGTCGACCCTCTAGAGGCTGCAGCCGACCCCGGATCCGGA 3' XbaI SalI XbaI PstI BamHI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI, BglI/ XmnI, EcoRI, EcoRI/PstI, EcoRV and PstI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by G. Maertens and Prof. Dr W. Min Jou(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Huylebroeck et al., Gene 66 (1988), 163-181 [PMID: 2844629] |
Related plasmid reference: | Tondeleir et al., Mol. Cell Proteomics 11 (2012), 255-271 [PMID: 22448045] [DOI: 10.1074/mcp.M111.015099] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.