GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPSDalphaSfiI/SfiI (LMBP 7310)

Add to cart

New search

Price category: Cat. 3 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: -
Sequence
analysis results
Genecorner:

NGS: a12-gc-dec2018.fasta

Cloned DNA: Saccharomyces cerevisiae α-mating factor 1 gene (MFα1, GeneID 855914); prepro secretion signal sequence (ppMF)
Saccharomyces cerevisiae alpha-agglutinin cDNA (SAG1, AG(ALPHA)1, GeneID 853460); C-terminal fragment
V5 epitope; C-terminal
Promoter: Pichia pastoris alcohol oxidase 1 promoter (AOX1)
Ribosome
binding site:
-
Terminator: Pichia pastoris alcohol oxidase 1 terminator (AOX1)
Selection marker: Ampicillin (amp)
Pichia pastoris HIS4; auxotrophic
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Pichia pastoris; his4(-), integrative
Parental clone: pPSDalphaE-selectin
Further information: The plasmid was constructed by inserting a linker between XhoI and ApaI in pPSDalphaE-selectin, after blunting both ends with T4 DNA polymerase. As a result, the plasmid contains two SfiI restriction sites after the S. cerevisiae ppMF sequence.
This P. pastoris surface display vector was adapted for library construction, allowing expression in P. pastoris as an alpha-agglutinin fusion.
The C-terminal fragment of SAG1 is highly glycosylated and contains a GPI anchor.
EMBL Accession number: -
Latest sequence update: 03/10/2018
Sequence detail:
The nucleotide sequence of the linker used for the construction of the plasmid:

5' GAAAAGAGAGGCCGAAGCGGCCTAGGGATAACAGGGTAATGGCCGGTGGGGC 3'
            SfiI                           SfiI
             BglI                           BglI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: HincII, NotI/XhoI and PvuI.

This plasmid has also been fully sequenced but the NGS sequence data still need to be implemented.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr N. Callewaert(1) (2).
(1) Center for Medical Biotechnology, VIB, Ghent, Belgium
(2) Department of Biochemistry and Microbiology, Ghent University, Ghent, Belgium
Plasmid reference: Ryckaert et al., J. Biotechnol. 145 (2010), 93-98 [PMID: 19861136] [DOI: 10.1016/j.jbiotec.2009.10.010]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search