GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPLcAT568-Bgal (LMBP 987)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p987.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Escherichia coli lac Z gene (lacZ)
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS); synthetic sequence
Terminator: Phage fd terminator
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pPLcAT14-Bgal; pPLcAT568-IFNB
Further information: This plasmid can be used for the expression of fused proteins at the unique sites in lacZ.
The plasmid construction is described in publications mentioned above. The nucleotide sequence was composed from these publications.Some minor streches are undefined.
EMBL Accession number: -
Latest sequence update: 06/05/1998
Sequence detail:
Nuceotide sequence of the leader region:

PL promoter -->|
5'...GCGTAGAGGA ATCAGCAGGACGCACTGACCACCATGAAGGTGACGCTCTTAAAATT

AAGCCCTGAAGAAGGGCAGCATTCGACCAAGGAGGTCTAG.ATG.GAT.CCC.GTC.GGT... 3'
                  BsmI      --------       BamHI
                              SD   XbaI

SD: Shine Dalgarno
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Stanssens et al., Gene 36 (1985), 211-223 [PMID: 3000873]
Related plasmid reference: Zabeau et al., EMBO J. 1 (1982), 1217-1224 [PMID: 6327257]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 ΔH1Δtrp
Host reference: Bernard et al., Gene 5 (1979), 59-76 [PMID: 372049]
Related host reference: Remaut et al., Gene 15 (1981), 81-93 [PMID: 6271633]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search