GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPLcAT10 (LMBP 1234)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: pplcat10.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS); synthetic sequence
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pPLc28
Further information: This plasmid derived from pPLc28 by inserting a synthetic DNA fragment, containing translational regulatory sequences, between the EcoRI and the HindIII site.
The portable, synthetic SD region is not preceded by the hIFNβ nucleotides.
The plasmid is designed for the expression of unfused proteins after BamHI digestion and S1 nuclease treatment of the 5' sticky ends.
pPLcAT10 can also be used for the expression of fused proteins with HindIII.
EMBL Accession number: -
Latest sequence update: 24/03/1992
Sequence detail:
Nucleotide sequence at the synthetic ribosome binding site:


                         SD
                      --------
5' GAATTCATCGATGTCGACCAAGGAGGTCTAG ATG.GAT.CCG.GCC.AAG.CTT 3'
   EcoRI       SalI          XbaI  * BamHI         HindIII


SD: Shine-Dalgarno position
 *: Initiation codon
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Stanssens et al., Gene 36 (1985), 211-223 [PMID: 3000873]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search