GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPLcA1 (LMBP 2469)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p2469.gb (View with Genome Compiler)
p2469.txt
p2469.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human Hepatitis B core protein gene (HBc); synthetic sequence
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS) of the phage MS2 polymerase gene
Terminator: Synthetic polyadenylation signal (polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pSP64; pPLc245
Further information: The construction of the plasmid is described in Nassal (1988).
The hepatitis B core protein gene (HBc) carries a modification as compared to the sequence presented in Fig. 2A in Nassal (1988): the BglII site at position 84 of HBc has been removed by a point mutation (AGATCT -> AGACCT).
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727519.1.
Name mentioned in Nassal (1988) is pPLc3-2/1.
EMBL Accession number: M20706, view at EMBL, GenBank, DDBJ
LT727519.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 03/12/1991
Sequence detail:
The sequence of the synthetic terminator : 

5' AGCTTCCGGGCCGGCGATAATACGCCGGCCCGTTTTTTTT 3'
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglII, BglII/NcoI, PvuI/XbaI and XbaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr M. Nassal(1).
(1) ZMBH, Heidelberg, Germany
Plasmid reference: Nassal et al., Gene 66 (1988), 279-294 [PMID: 2901997]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search