GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPLc2819FdT1 (LMBP 741)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p741.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
-
Terminator: Phage fd terminator
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pPLc2819
Further information: The plasmid contains fd terminator (fdT) and the lac operator fragment (lacO) flanked by several unique restriction sites, and the in a functional orientation relative to the λ-PL promoter.
The orientation of the 'fdT-lacO' fragment was experimentally verified.
The lac operator fragment is suitable as a screeningsmarker on lacZ indicator plates in lac positive strains.
The HindIII, PstI and XbaI expression sites are not unique.
EMBL Accession number: -
Latest sequence update: 03/04/1989
Sequence detail:
Nucleotide sequence downstream from the PL promoter:

5' GAATTCCGGATCCGGCCAAGCTTGGCTCTAGAGGCTGCAGCCTCTAGAGGGTCGAAATT 3'
   EcoRI  BamHI     HindIII  XbaI    PstI    XbaI
       BspMII
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli W6 (λrex)
Host reference: -
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search