GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPLT10mIFNBmT (LMBP 3659)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p3659.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse interferon β cDNA (IFNB); mutated mature sequence
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLT10T3; pMacT10mIFNBm
Further information: The plasmid was constructed by inserting the NdeI/HindIII fragment of pMacT10mIFNBm, containing the mature, mouse interferon β (IFNB) gene, between the NdeI and HindIII sites of the pLT10T3 vector.
pPLT10mIFNBmT is an expression phasmid for mutated mouse IFNB in Escherichia coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter.
The mutations in the mature mouse IFNB gene should lead to the formation of intra-chain disulfide bonds in the expressed protein, resulting in a more stable product.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
Other name of the plasmid is pPLT10mIFNBm.
EMBL Accession number: -
Latest sequence update: 04/05/1999
Sequence detail:
Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:
                    |
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT 
   ---------------->|                     XbaI
     T7 promoter
                           1   2   3   4   5   6 
   TAAGAAGGAGATATACAT ATG.ATC.ACC.TAT.AAG.CAG.CTC … 3'
       ------     NdeI   |--> mature IFNB     
         SD        

  
Nucleotide sequence around the codon at amino acid position 17 of the mature mIFNB gene:
                        14  15  16  17  18  19  20
                       Ile Arg Lys Cys Gln Glu Leu
wt mIFNB:      5' ... .ATT.CGG.AAA.TGT.CAG.GAG.CTC. ... 3'
                                           SacI

                        14  15  16  17  18  19  20
                       Ile Arg Lys Ser Gln Glu Leu
mutated mIFNB: 5' ... .ATT.CGG.AAA.TCC.CAG.GAG.CTC. ... 3'
                                    **     SacI
                                    BsaJI

Nucleotide sequence around the codon at amino acid position 29 of the mature mIFNB gene:
                        26  27  28  29  30  31  32
                       Gly Lys Ile Asn Leu Thr Tyr
wt mIFNB:      5' ... .GGA.AAG.ATC.AAC.CTC.ACC.TAC. ... 3'

                        26  27  28  29  30  31  32
                       Gly Lys Ile Cys Leu Thr Tyr
mutated mIFNB: 5' ... .GGA.AAG.ATC.TGC.CTC.ACC.TAC. ... 3'
                            BglII  **

Nucleotide sequence around the codons at amino acid positions 136 and 137 of the mature mIFNB gene:
                       133 134 135 136 137 138 139
                       Tyr Asn Ser Tyr Ala Trp Met
wt mIFNB:      5' ... .TAC.AAC.AGC.TAC.GCC.TGG.ATG. ... 3'
                                        BstNI

                       Tyr Asn Ser Cys Ala Trp Met
mutated mIFNB: 5' ... .TAC.AAC.AGC.TGC.GCA.TGG.ATG. ... 3'
                             PvuII  *    *
                                   FspI
SD: Shine-Dalgarno.
 *: Mutated nucleotide
Punctuation indicates reading frame.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061[pICA2]
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Helper plasmid: pICA2
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml) + kanamycin (50 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search