GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 24 November 2020 04:18 CET

Plasmid name: pPCV (LMBP 9004)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p9004.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Saccharomyces cerevisiae uracil 3 (URA3); stuffer fragment
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ)
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Parental clone: pBluesScriptIIKS
Further information: The plasmid was constructed by PCR amplifying a 522 bp fragment of the S. cerevisiae URA3 gene from pNKY51 and cloning it as a SacI/KpnI fragment into the SacI/KpnI opened pBlueScriptIIKS vector.
The URA3 stuffer fragment can be removed using XcmI, which produces 3' T overhangs that can be used for cloning PCR products derived from amplification by Taq polymerase. Alternatively, the stuffer fragment can be removed using EcoRV, which yields blunt-ends suitable for cloning PCR products generated by Pfu DNA polymerase.
The vector is suitable for blue/white selection of transformants when using EcoRV to remove the stuffer fragment.
EMBL Accession number: -
Latest sequence update: 20/02/2014
Sequence detail:
Primers used to amplify the URA3 stuffer fragment: 

Forward: 5′ AAGGTACCGATATCTCCAATACTTGTATGGAGGGCACAGTTAAGCC
              KpnI  EcoRV  XcmI

Reverse: 5′ AAGAGCTCGATATCCTCCAATACTCCTTTGGATCCCTTCCCTTTGCAAATAGT
              SacI  EcoRV   XcmI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr F. Torres(1).
(1) Departamento de Biologia Celular, Universidade de Brasilia, Brasilia, Brazil
Plasmid reference: Janner et al., Springerplus 2:441 (2013) [PMID: 24058893]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search