GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 28 November 2020 04:24 CET

Plasmid name: pMc514 (LMBP 1464)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: pmc514.gb (View with Genome Compiler)
pmc514.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS); synthetic sequence
Terminator: Phage fd terminator
Selection marker: Chloramphenicol (cam)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pMc5-βg14
Further information: This phasmid was designed for site-specific mutagenesis.
pMc514 can be used for direct expression screening after a mutagenesis treatment; recloning is not necessary.
The phasmid provides resistance to chloramphenicol, but is sensitive to ampicillin.
pMc514 contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7.
The AccI, PstI, SalI and XbaI expression sites are not unique.
The BsePI site in front of the λ PL promoter is still present.
After mutagenesis, use mutS and λ lysogen strains for primary transformation; for segregation of possible mutants: sup(-) and λ lysogen strains.
EMBL Accession number: -
Latest sequence update: 02/04/1992
Sequence detail:
Nucleotide sequence downstream from the PL promoter:

5' GAATTCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGTCGACC
   EcoRI                                                   AccI
                                                        SalI StyI


   AAGGAGGTCTAG ATG.GAT.CCG.TCG.ACC.TGC.AGC.CAA.GCT.TGG.TCT.AGA 3'
   --------       BamHI   AccI    PstI       HindIII    XbaI
      SD  XbaI            SalI  BspMI


SD: Shine-Dalgarno position.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Csp45I, EcoRI and RsaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr P. Stanssens(1).
(1) Corvas International N.V., Ghent, Belgium
Plasmid reference: Stanssens et al., Nucleic Acids Res. 17 (1989), 4441-4454 [PMID: 2501754]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + chloramphenicol (25 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search