GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 28 November 2020 04:24 CET

Plasmid name: pMc254mSA (LMBP 2148)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p2148.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: -
Ribosome
binding site:
-
Terminator: Phage fd terminator
Selection marker: Chloramphenicol (cam)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Parental clone: pMc254
Further information: In this construction, the natural termination codon of the ampicillin resistance gene was extinguished by site-specific mutagenesis, creating a unique SacI site and a unique ApaI site.
The phasmid provides resistance to chloramphenicol, but is sensitive to ampicillin in a sup(-) strain.
The mutated β-lactamase is still biologically functional in a sup(+) strain (e.g. B3), it is 19 amino acids longer than the natural form.
The f1 part of the plasmid contains the F1-ori, but also the sequence around the gene II promoter; the two trp terminators at the end of the chloramphenicol gene are not present.
After mutagenesis, use mutS strains for primary transformation (e.g. sup(-) strain WK6mutS, sup(+) strain BMH71-18mutS); for segregation of possible mutants: sup(-) strains (e.g. WK6).
This plasmid is transformed to the suppressor strain B3
Other name of the plasmid is pMc254SA.
EMBL Accession number: -
Latest sequence update: 31/07/1990
Sequence detail:
Nucleotide sequence at the end of the natural ampicillin gene:

5' CTG.ATT.AAG.CAT.TGG.TAA CTGTCAGACCAAGTTTACTC ATATATACTTTAGATTGATTT
                       *1

   AAAACTTCATTTTTAA 3'

Nucleotide sequence of the mutated ampicillin gene:

                      linker
   --------------------------------------------------
5' CTG.ATT.AAG.CAT.TGG.GAG.CTC.TCA.GGG.CCC.GTT.TAC.TCA.TAT.ATA.CTT.TAG
                       SacI        ApaI                            *2

   ATT GAT TTA AAA CTT CAT TTT TAA 3'
                               *3

*1:  Termination codon of the natural ampicillin gene.
*2:  Amber termination codon of the mutated ampicillin gene.
*3:  Termination codon of the mutated ampicillin gene in an amber sup+ strain.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by K. De Sutter(1) and Prof. Dr W. Fiers(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + chloramphenicol (25 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search