GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 28 November 2020 04:24 CET

Plasmid name: pMCQ (LMBP 2977)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: pmcq.gb (View with Genome Compiler)
pmcq.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Parental clone: pBluescriptIIKS+
Further information: This plasmid was constructed by inserting a 260 bp sense primer sequence and a 281 bp antisense primer sequence between the PstI-HindIII and SalI-KpnI sites of the polylinker of pBluescriptIIKS+, respectively.
The cytokine primer sequences are flanked in 5' by T7 RNA polymerase and in 3' by a polyA sequence.
This plasmid is used for the quantification of cytokine mRNA levels by competitive PCR. It contains a synthetic 550 bp DNA fragment harboring sequences which allow PCR amplification of parts of the control fragment with primers specific for nine mouse cytokine genes (IL-1 to IL-6, TNFα, lymphotoxin, IFNγ) and the β-actin gene.
Check the primers for intron/exon overlap or an inserted intron in the amplified product if you do RT-PCR. Otherwise, it is possible to co-amplify contaminating genomic DNA.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727564.1.
EMBL Accession number: LT727564.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 03/05/1994
Sequence detail:
sense primers   5' -> 3'

TNFalpha             GGCAGGTCTACTTTGGAGTCATTGC

IL2                  TGATGGACCTACAGGAGCTCCTGAG

IL5                  ATGACTGTGCCTCTGTGCCTGGAGC

IL4                  CGAAGAACACCACAGAGAGTGAGCT

IL3                  GAAGTGGATCCTGAGGACAGATACG

IL6                  TGGAGTCACAGAAGGAGTGGCTAAG

IL1alpha             CTCTAGAGCACCATGCTACAGAC

lymphotoxin          TGGCTGGCAACAGGGGAAGGTTGAC

IFNG                 AGCGGCTGACTGAACTCAGATTGTAG

beta ACTIN           TGGAATCCTGTGGCATCCATGAAAC



antisense primers    5' -> 3'



polyA           TTTTTTTTTTTTTTTTTTTTTTTTT

IFNG            GTCACAGTTTTCAGCTGTATAGGG

beta ACTIN      TAAAACGCAGCTCAGTAACAGTCCG

lymphotoxin     CGTGCTTTCTTCTAGAACCCCTTGG

TNFalpha        ACATTCGAGGCTCCAGTGAATTCGG

IL6             TCTGACCACAGTGAGGAATGTCCAC

IL5             CTGTTTTTCCTGGAGTAAACTGGGG

IL4             GACTCATTCATGGTGCAGCTTATCG

IL3             GACCATGGGCCATGAGGAACATTC

IL2             GAGTCAAATCCAGAACATGCCGCAG

IL1alpha        TGGAATCCAGGGGAAACACTG
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AvaII, BglI, EcoRI and PvuII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr T. Blankenstein(1).
(1) Humboldt Universitat, Berlin
Plasmid reference: Platzer et al., Eur. J. Immunol. 22 (1992), 1179-1184 [PMID: 1533590]
Related plasmid reference: Murray et al., Eur. J. Immunol. 20 (1990), 163-170 [PMID: 1968391]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search