GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 25 September 2020 04:24 CEST

Plasmid name: pLoxGentrc (LMBP 9151)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p9151.gb (View with Genome Compiler)
Sequence
analysis results
Genecorner:

-

Cloned DNA: Escherichia coli lac repressor gene (lacI)
Promoter: Escherichia coli hybrid tryptophan/lacUV5 promoter (trc)
Escherichia coli lac repressor promoter; mutant (lacIq)
Escherichia coli lac operon promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ)
Terminator: Escherichia coli rrnB operon T1 terminator
Escherichia coli rrnB operon T2 terminator
Selection marker: Ampicillin (amp)
Gentamicin (Gm)
Replicon: Escherichia coli plasmid pMB1 origin
Bacteriophage M13 origin
Host range: Escherichia coli
Parental clone: pLoxGen4
Further information: The plasmid was constructed based on pLoxGen4 by digesting it with HindIII and religating the backbone after blunting, eliminating this restriction site. A 2266 bp region containing lacIq, the trc promoter, the multicloning site and the T1 and T2 terminator sequences was PCR-amplified from pTrc99A and ligated as a BstZ117I/NotI fragment into the EcoRI (blunted)/NotI opened intermediary vector.
pLoxGentrc is meant for chromosomal gene integration and expression in E. coli.
The nucleotide sequence of the pLoxGentrc vector corresponds with the EMBL Nucleotide Sequence Database accession number JF934954.1.
EMBL Accession number: JF934954.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 05/05/2014
Sequence detail:
Primers used to amplify the 2266 bp region of pTrc99A containing lacIq, trc promoter, MCS and T1 and T2 terminator:

Ptrcup:	  5' CTGATGCCGCATAGTTAAGCCA 3'


Ptrcdown: 5' ATAAGAATGCGGCCGCGGGTTATTGTCTCATGAGCGG 3'
                     NotI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: HincII, PvuII and XhoI.

As compared to the compiled nucleotide sequence, one HincII site probably at position 2715 could not be experimentally confirmed.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr Guillermo Gosset Lagarda(1). It was constructed by A. Sabido(1).
(1) Departamento de Ingenieria Celular y Biocatalisis, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Mexico
Plasmid reference: Sabido et al., Plasmid 69 (2013), 16-23 [PMID: 22884755] [DOI: 10.1016/j.plasmid.2012.04.005]
Related plasmid reference: Palmeros et al., Gene 247 (2000), 255-264 [PMID: 10773465]
Restricted distribution: - BCCM MTA
- The depositor will be informed of the customer's identity upon release of a sample outside the depositor's department or outside the departments in which BCCM/GeneCorner is embedded, namely UGent-DBMB and VIB-IRC.
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml) + gentamicin (10 μg/ml)*
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: *: selection of transformants on gentamicin; subsequent cultivation of a single colony in liquid medium with ampicillin.
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search