GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 04 December 2020 04:17 CET

Plasmid name: pLT10lacZT3 (LMBP 3520)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3520.gb (View with Genome Compiler)
p3520.txt
p3520.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Escherichia coli lac Z gene (lacZ); with modified 5' end and missing the EcoRI site at the 3' end
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLT10T3; pMC1403; pLT10Bgal
Further information: This plasmid was constructed by inserting the XbaI/SacI fragment from pLT10Bgal, containing the ribosome binding site of the phage T7 gene 10 and part of the E. coli lacZ coding sequence, and the SacI/SgrAI fragment from pMC1403, containing the remaining part of the lacZ coding sequence in which the EcoRI site was removed, between the XbaI and EagI sites of the pLT10T3 vector. The SgrAI and EagI sites were filled in with Klenow DNA polymerase.
This is a useful phasmid for LacZ expression in E. coli under control of the strong and efficiently regulatable λ PL or T7 promoter. Transcriptional read-through from these promoters is minimized by the presence of a duplicated T7 transcription terminator sequence for the T7 RNA polymerase and a duplicated fd transcription terminator sequence for the E. coli RNA polymerase. Opposed to the pET-vectors, read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727347.1.
EMBL Accession number: LT727347.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 09/01/2001
Sequence detail:
Nucleotide sequence at the start of the lacZ coding sequence:



                        
       -- T7 promoter ->                                             --- lacZ -->
5' ... TAATACGACTCACTATAGGGAGACCA ... TAAGAAGGAGATATACAT.ATG.GAT.CCC.GTC.GTT.TTA ... 3'
                                          --SD--         ***         ^^^
                                                           BamHI
***: start codon.
^^^: tenth codon of the E. coli lacZ gene.
SD : Shine-Dalgarno sequence.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BanII, BssHII, BssHII/EcoRI, DraI, EcoRI, EcoRI/PstI, PstI and SacI/XbaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1) (2). It was constructed by K. Keymeulen(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search