Last data update: 17 January 2021 04:22 CET
Plasmid name: pLT10TH (LMBP 3385)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p3385.gb
(View with Genome Compiler) p3385.txt p3385.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Histidine tag (His-tag); N-terminal Enterokinase cleavage site (EK); N-terminal |
Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
Parental clone: | pLF10T; pLT10T3 |
Further information: | The construction of this plasmid is described in figure 2 of Mertens et al., Gene 164 (1995), 9-15. The linker composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene) was fused to the resected KpnI site in the linker of pLT10T3. This is a useful plasmid for heterologous gene expression in E. coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of the duplicated T7 and fd terminators. Opposed to the pET-vectors, read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. Furthermore, pLT10TH also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727477.1. |
EMBL Accession number: | LT727477.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 03/04/1996 |
Sequence detail: | Nucleotide sequence following the T7 promoter: -- T7 promoter -> --------------- 5' UTR T7 gene 10 ----------- 5' ... ACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT XbaI -----------------> ------- His-tag ------> ------- TAAGAAGGAGATATACAT.ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT --SD-- *** Asp Pro His His His His His His Asp Asp NdeI BamHI EK -------> GAC.GAT.AAG.GCG.CCC.GGG.TTC.GAA.ATC.GAT.AAG.CTT.ATG.CAT.GCG Asp Asp Lys SmaI AsuII ClaI HindIII NsiI NotI NarI + ++ SphI GCC.GCA.TCT.AGA.GGG.CCC.GGA.TCC.CTC.GAG.GTC.GAC.GAA.TTC.GAG XbaI ApaI BamHI XhoI SalI EcoRI SacI + ++ HindII <---- T3 promoter ---- CTC.GGC.CGA.CTT.GGC.CTT.CCC.TTT.AGT.GAG.GGT.TAA.TAAAC ... 3' SfiI + +++ ++ +++ +++ BglI ***: start codon. +++: termination codon. EK : enterokinase recognition site. SD : Shine-Dalgarno sequence. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI, HindII and HindIII. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061(λ) |
Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.