GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 26 September 2020 04:22 CEST

Plasmid name: pLT10TH (LMBP 3385)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3385.gb (View with Genome Compiler)
p3385.txt
p3385.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Histidine tag (His-tag); N-terminal
Enterokinase cleavage site (EK); N-terminal
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLF10T; pLT10T3
Further information: The construction of this plasmid is described in figure 2 of Mertens et al., Gene 164 (1995), 9-15. The linker composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene) was fused to the resected KpnI site in the linker of pLT10T3.
This is a useful plasmid for heterologous gene expression in E. coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of the duplicated T7 and fd terminators. Opposed to the pET-vectors, read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin.
Furthermore, pLT10TH also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727477.1.
EMBL Accession number: LT727477.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 03/04/1996
Sequence detail:
Nucleotide sequence following the T7 promoter:

   -- T7 promoter ->
                    --------------- 5' UTR T7 gene 10 -----------
5' ... ACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
                                         XbaI

   ----------------->             ------- His-tag ------> -------
   TAAGAAGGAGATATACAT.ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT
       --SD--         *** Asp Pro His His His His His His Asp Asp
                  NdeI  BamHI                             

   EK ------->                            
   GAC.GAT.AAG.GCG.CCC.GGG.TTC.GAA.ATC.GAT.AAG.CTT.ATG.CAT.GCG
   Asp Asp Lys     SmaI    AsuII   ClaI    HindIII NsiI    NotI
             NarI                        + ++        SphI

   GCC.GCA.TCT.AGA.GGG.CCC.GGA.TCC.CTC.GAG.GTC.GAC.GAA.TTC.GAG
           XbaI    ApaI    BamHI   XhoI    SalI    EcoRI   SacI
             + ++                          HindII

                               <---- T3 promoter ----
   CTC.GGC.CGA.CTT.GGC.CTT.CCC.TTT.AGT.GAG.GGT.TAA.TAAAC ... 3'
       SfiI                      + +++ ++      +++ +++
        BglI

***: start codon.
+++: termination codon.
EK : enterokinase recognition site.
SD : Shine-Dalgarno sequence.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglI, HindII and HindIII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search