GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 04 December 2020 04:17 CET

Plasmid name: pLT10T (LMBP 3281)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p3281.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: -
Further information: pLT10T was designed for bacterial expression of heterologous genes after an ApaI digestion and blunting the 3' sticky ends with T4 DNA polymerase, making the ATG start codon on the plasmid accessible for blunt-end ligation to fragments encoding the mature coding sequence.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
Other name of the plasmid is pPLT10T.
EMBL Accession number: -
Latest sequence update: 30/03/1995
Sequence detail:
Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:

      -- T7 promoter ->
5'... TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
                                            XbaI
                      
      TAAGAAGGAGATATACAT.ATG.GGC.CCG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG
          --SD--         ***       AatII   SphI        XbaI    XhoI
                     NdeI  ApaI

      AGG.AAT.TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA. ...3'
        EcoRI   KpnI   SmaI    AsuII   ClaI   +++      
                                               HindIII     
     
***: start codon.
+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: ApaI, EcoRI, HincII and RsaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr N. Mertens(1) (2) and Prof. Dr E. Remaut(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search