GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 04 December 2020 04:17 CET

Plasmid name: pLT10LUCT3 (LMBP 3326)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3326.gb (View with Genome Compiler)
p3326.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Photinus pyralis (firefly) luciferase gene (LUC)
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLT10T3; pSV2L5m
Further information: This plasmid was constructed by inserting the mutated hybrid (genomic-cDNA) Photinus pyralis (firefly) luciferase gene (LUC) as a PstI-SstI(SacI) fragment between the ApaI-SstI(SacI) sites of pLT10T3. The PstI and ApaI sites were blunted with Klenow DNA polymerase.
This is a useful phasmid for heterologous gene expression in Escherichia coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of a duplicated T7 transcription terminator sequence for the T7 RNA polymerase and a duplicated fd transcription terminator sequence for the E. coli RNA polymerase. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin.
pLT10LUCT3 is provided with an antisense phage T3 promoter.
This phasmid also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857]. Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727465.1.
EMBL Accession number: LT727465.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 05/09/1997
Sequence detail:
Nucleotide sequence around the Shine-Dalgarno (SD) position of the T7 gene 10 
ribosome binding site:

                              ---------------------- 5'UTR of T7g10 
             -- T7 promoter ->
5' ... GGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTG
                                                   XbaI


       5'UTR of T7g10 ----------> ------------- LUC -------------> 
       TTTAACTTTAAGAAGGAGATATACAT.ATG.GAA.GAC.GCC.AAA.AAC.ATA.AAG ... 3'
                   ------         Met Glu Asp Ala Lys Asn Ile Lys 
                     SD           ***
                              NdeI

  
***: Start codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AvaII, EcoRI, HindII/SacI and PstI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr E. Remaut(1)(2). It was constructed by K. Keymeulen(1)(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search