Last data update: 15 January 2021 04:14 CET
Plasmid name: pLT-mCASP-8 (LMBP 3807)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p3807.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Mouse cysteinyl aspartate specific proteinase 8 cDNA (caspase-8, CASP-8, Casp8, MCH5, MACH, FLICE); p30 precursor Histidine tag (His-tag); N-terminal Enterokinase cleavage site (EK); N-terminal |
Promoter: | Phage λ major leftward promoter (λ PL) Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
Parental clone: | pLT10TH; EST clone 533745 |
Further information: | This p30 caspase-8 phasmid was constructed by ligating an EcoRI/EcoRV amplicon, obtained by PCR on EST clone 533745, to the EcoRI-PstI and PstI-EheI vector fragments from pLT10TH. The phasmid can be used to make in vitro translated p30 forms of the inserted caspase. The H6EK linker is composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This H6EK linker directly follows the ATG start codon. Transcriptional read-through from the promoters is minimized by the presence of a duplicated T7 transcription terminator and a duplicated fd transcription terminator. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. Furthermore, the phasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. Other names of the plasmid are pLT-mCASP-8p30, pLTP30casp8#1 and pltmMACH30. |
EMBL Accession number: | - |
Latest sequence update: | 21/11/1998 |
Sequence detail: | Nucleotide sequence at the N-terminus of the fusion: | 5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT ---------------->| XbaI T7 promoter TAAGAAGGAGATATACAT ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT. ------ NdeI Asp Pro His His His His His His Asp Asp SD BamHI ----------------------- ------- *1 *2a |--> mCASP-8 |219 GAC.GAT.AAG^GCA.TTC.AGT.GAG.TCA.CGG.ACT.TCA. … 3' Asp Asp Lys ----------- *2b SD: Shine-Dalgarno. *1: Metal chelating affinity tail. *2a: First part of the enterokinase site. *2b: Completing part of the enterokinase site. ^: Cleavage site of the enterokinase. Primer sequences: forward primer: 5' GCG GAT ATC CAG TGA GTC ACG GAC TTC AGA CAA AG 3' EcoRV reverse primer: 5' GCG GAT ATC GAA TTC TCA TTA GGG AGG GAA GAA GAG CTT C 3' EcoRV EcoRI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
Related plasmid reference: | Van de Craen et al., J. Mol. Biol. 284 (1998), 1017-1026 [PMID: 9837723] Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] Van de Craen et al., Cell Death Differ. 5 (1998), 838-846 [PMID: 10203698] Van de Craen et al., Cell Death Differ. 6 (1999), 1117-1124 [PMID: 10578181] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061(λ) |
Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.