GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 26 September 2020 04:22 CEST

Plasmid name: pLT-mCASP-7p30 (LMBP 3799)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p3799.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse cysteinyl aspartate specific proteinase 7 cDNA (caspase-7, CASP-7, Casp7, Mch3); p30 precursor
Histidine tag (His-tag); N-terminal
Enterokinase cleavage site (EK); N-terminal
Strep-tag; C-terminal
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Phage λ major leftward promoter (λ PL)
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLT-mCASP-1p30-2; pEFBOSp30B
Further information: The plasmid was created by replacing the NcoI/NheI fragment from pLT-mCASP-1p30-2 by the NcoI/NheI fragment from pEFBOSp30B, containing p30 mouse caspase-7 cDNA.
The plasmid can be used to make in vitro translated p30 forms of the inserted caspase.
The H6EK linker is composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This H6EK linker directly follows the ATG start codon.
Transcriptional read-through from the promoters is minimized by the presence of a duplicated T7 transcription terminator and a duplicated fd transcription terminator. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin.
Furthermore, the plasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3). Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
The nucleotide sequence of the mCASP-7 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number Y13088.1.
Name mentioned in Van de Craen et al. (1999) is pLTmCASP-7.
Other names of the plasmid are pLT p30B and plt30Bsh.
EMBL Accession number: Y13088.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 21/10/1998
Sequence detail:
Nucleotide sequence at the N-terminus of the fusion:

                    |
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
   ---------------->|                     XbaI
     T7 promoter
                                         
                      ***  
   TAAGAAGGAGATATACAT ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT.
       ------     NdeI    Asp Pro His His His His His His Asp Asp
         SD             BamHI     ----------------------- -------
                                           *1               *2a
              
                          |--> murine caspase-7
                          | 24
   GAC.GAT.AAG^GCA.TCC.ATG.GCC.AAG.CCA.GAC.CGC...3'
   Asp Asp Lys      NcoI
   -----------          
      *2b    

             
Nucleotide sequence at the C-terminus of the fusion:

          mCASP-7 -->|
          300     302|        
 5'...TAC.TTC.AGC.CGT.GCT.AGC.GCT.TGG.CGC.CAC.CCC.CAG.TTT.GGT.GGT.
                          Ser Ala Trp Arg His Pro Gln Phe Gly Gly 
                      NheI---------------------------------------
                                   Strep tag

   TAA.TAGGATCCGGCAATTGAATTCGAGCTCGGC... 3'
   +++    BamHI   MfeI EcoRI    


***: start codon.
+++: termination codon.
SD: Shine-Dalgarno.
*1: Metal chelating affinity tail.
*2a: First part of the enterokinase site.
*2b: Completing part of the enterokinase site.
^: Cleavage site of the enterokinase.
Punctuation indicates reading frame.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr M. Van de Craen(1) (2) and Prof. Dr P. Vandenabeele(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Van de Craen et al., Cell Death Differ. 6 (1999), 1117-1124 [PMID: 10578181]
Restricted distribution: -
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search