Last data update: 26 September 2020 04:22 CEST
Plasmid name: pLT-mCASP-1p30-1 (LMBP 3805)
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p3805.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: | Mouse cysteinyl aspartate specific proteinase 1 cDNA (caspase-1, CASP-1, ICE, Casp1); p30 subunit Histidine tag (His-tag); N-terminal Enterokinase cleavage site (EK); N-terminal Strep-tag; C-terminal |
| Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Phage λ major leftward promoter (λ PL) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator: | Phage fd terminator Phage T7 gene 10 terminator (T7g10) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
| Host range: | Escherichia coli; use strains with a cI function, cIts for PL controlled expression |
| Parental clone: | pLT10TH |
| Further information: | The plasmid was created as follows: 1) a ΔproCASP-1 construct was made via PCR, using pGEM-mCASP-1 as a template. The PCR was carried out using synthetic oligonucleotide primers designed to eliminate the N-terminal region corresponding to the prodomain of caspase-1, to add an EcoRV and KpnI restriction site upstream of an inserted methionine start codon and to append a 10 amino acids strep-tag to the C-terminus, followed by two termination codons as well as BamHI, MunI (MfeI) and EcoRI restriction sites. 2) The PCR amplicon was digested with EcoRV and EcoRI and inserted into the EcoRV/EcoRI opened pLT10TH plasmid downstream from the His-tag and EK site. This plasmid differs from pLT-mCASP-1p30-2 only by the presence of a unique KpnI site upstream of the p30 fragment. The plasmid can be used to make in vitro translated p30 forms of the inserted caspase. The His-tag and EK site linker is composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This His-tag and EK site linker directly follows the ATG start codon. Transcriptional read-through from the promoters is minimized by the presence of a duplicated T7 transcription terminator and a duplicated fd transcription terminator. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin. Furthermore, the plasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7. For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3). Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. The nucleotide sequence of the mouse mCASP-1cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC008152.1. Name mentioned in Schotte et al. (1998) is pLTΔproCASP-1a. Name mentioned in Van de Craen et al. (1999) is pLTmCASP-1a. Other names of the plasmid are pltP30ice(KpnI)#K2, pLT-mCASP-1a and plt30k3p. |
| EMBL Accession number: | BC008152.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 13/08/1998 |
| Sequence detail: | Nucleotide sequence at the N-terminus of the fusion:
|
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
---------------->| XbaI
T7 promoter
TAAGAAGGAGATATACAT ATG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT.
------ *** Asp Pro His His His His His His Asp Asp
SD NdeI BamHI ----------------------- -------
*1 *2a
|--> mCASP-1
|123 125
GAC.GAT.AAG^GCA.TCG.GTA.CCT.GCC.ACC.ATG.GGC.ACA.TTT.CCA.GGA. … 3'
Asp Asp Lys KpnI NcoI
-----------
*2b
Nucleotide sequence at the C-terminus of the fusion:
mCASP-1 -->|
400 402|
5' ... .TTC.CCG.GGA.CAT.GCT.AGC.GCT.TGG.CGC.CAC.CCC.CAG.TTT.GGT.GGT.
Ser Ala Trp Arg His Pro Gln Phe Gly Gly
---------------------------------------
strep-tag
TAA.TAGGATCCGGCAATTGAATTCGAGCTCGGC ... 3'
+++ BamHI MfeI EcoRI
***: start codon.
+++: termination codon.
SD: Shine-Dalgarno.
*1: Metal chelating affinity tail.
*2a: First part of the enterokinase site.
*2b: Completing part of the enterokinase site.
^: Cleavage site of the enterokinase.
Punctuation indicates reading frame. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Schotte et al., Biochem. Biophys. Res. Commun. 251 (1998), 379-387 [PMID: 9790964] |
| Related plasmid reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] Van de Craen et al., Cell Death Differ. 6 (1999), 1117-1124 [PMID: 10578181] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061(λ) |
| Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
| Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | Cultivate for at least 20 hours. |
| Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.