Last data update: 15 January 2021 04:14 CET
Plasmid name: pLJM34 (LMBP 9310)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p9310.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Yersinia enterocolitica outer membrane adhesin protein gene (yadA, P1, yopA); modified sequence (yadA545+) |
Promoter: | Escherichia coli lac operon promoter Phage T7 gene 10 promoter (T7g10) Phage T3 promoter |
Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
Terminator: | - |
Selection marker: | Neomycin (neo; kanamycin (kan)) |
Replicon: | Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon |
Host range: | Escherichia coli Gram-negative bacterial strains |
Parental clone: | pBBR1MCS-2; pLJM32; pMS8 |
Further information: | The plasmid was constructed by amplifying the yadA545+ CDS via inverse PCR on pLJM32 and cloning it into the pBBR1MCS-2 vector, followed by insertion of the PvuII fragment from pMS8 containing yadA686-956. Other names of the plasmid are pBBRMCS2:yadA545+, pYadALONG and pYadA545. |
EMBL Accession number: | - |
Latest sequence update: | 03/07/2014 |
Sequence detail: | Primers used to create the yadA545+ CDS: Forward: 5' CTGATTTTTTATTTGTATTTTCCTGT Reverse: 5' CTGAGCTGTTAGCAAAGCC |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr G. Cornelis(1). It was constructed by Dr J. Mota(2). (1) Research Unit in Microorganism Biology, University of Namur, Namur, Belgium (2) Biozentrum, University of Basel, Switzerland |
Plasmid reference: | Mota et al., Science 307 (2005), 1278 [PMID: 15731447] |
Restricted distribution: | - BCCM MTA - The depositor will be informed of the customer's identity upon release of a sample outside the depositor's department or outside the departments in which BCCM/GeneCorner is embedded, namely UGent-DBMB and VIB-IRC. |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 LK111 |
Host reference: | Zabeau et al., EMBO J. 1 (1982), 1217-1224 [PMID: 6327257] |
Cultivation medium: | LB-Lennox + kanamycin (50 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.