GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 26 September 2020 04:22 CEST

Plasmid name: pLF10T4 (LMBP 3386)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: plf10t4.gb (View with Genome Compiler)
plf10t4.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: -
Promoter: Phage λ major leftward promoter (λ PL)
Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Ribosome
binding site:
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator: Phage fd terminator
Phage T7 gene 10 terminator (T7g10)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli; use strains with a cI function, cIts for PL controlled expression
Parental clone: pLF10T; pLT10T3
Further information: The construction of this phasmid is described in figure 2 of Mertens et al., Gene 164 (1995), 9-15.
This is a useful phasmid for heterologous gene expression in Escherichia coli under control of the strong and efficiently regulatable λ PL or T7 gene 10 promoter. Transcriptional read-through from these promoters is minimized by the presence of a duplicated T7 transcription terminator sequence for the T7 RNA polymerase and a duplicated fd transcription terminator sequence for the E. coli RNA polymerase. Read-through transcription from other plasmid promoters is minimized by the clockwise orientation of the PL and T7 promoters relative to the anticlockwise orientation of the replication origin.
pLF10T4 contains a linker (H6EK) composed of a hexameric histidine-encoding fragment (allowing the synthesis of affinity-tagged fusion proteins) followed by the enterokinase recognition site (allowing the precise release of the mature heterologous gene). This H6EK linker is fused to the first 14 codons of T7g10. The presence of these 14 codons of T7g10 provides for optimal translation initiation.
The phasmid is designed for insertion of the gene of interest between the BbeI site (or one of its neoschizomers) and a site at choice of the extended multicloning site downstream from the PL and T7 promoters. Desired coding sequences may be fused in frame to the enterokinase site by joining to either the BbeI, NarI or KasI cut sequence.
Furthermore, the phasmid is provided with an antisense phage T3 promoter. It also contains the replication origin of the single-stranded DNA phage f1, so that it can be rapidly switched between the plasmid and the phage mode (ssDNA) of replication. The latter requires infection with a helper phage, e.g. M13KO7.
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857].
Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727478.1.
The nucleotide sequence was obtained from Nico Mertens.
EMBL Accession number: LT727478.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 06/04/1996
Sequence detail:
Nucleotide sequence following the Shine-Dalgarno (SD) position of the T7 gene 10 ribosome binding site:



                    |
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
   ---------------->|                     XbaI
     T7 promoter


                      ---> T7g10
                       1               5                   10
   TAAGAAGGAGATATACAT ATG.GCT.AGC.ATG.ACT.GGT.GGA.CAG.CAA.ATG.GGT
       ------     NdeI
         SD


      T7g10  -->|                       linker
            14  |   --------------------------------------------
   ACT.AAC.CAA.G|CG.GAT.CCA.CAT.CAC.CAT.CAC.CAT.CAC.GAC.GAT.GAC.
         -------|   Asp Pro His His His His His His Asp Asp Asp
                | BamHI     ----------------------- -----------
         Filled-in                    *1               *2a
         StyI site


            KasI/ApaI fusion
                |
   -------------|-                       @
   GAT.AAG^GCG.C|CG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG.AGG.AAT.
   Asp Asp Asp Lys        SphI        XbaI    XhoI    EcoRI
   -----------    AatII                       AvaI
     *2b
         NarI
         



         
                                   @
   TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA.GCT.TAT.GCA.TGC.GGC.CGC.
     KpnI   SmaI    AsuII   ClaI    HindIII NsiI    NotI    
            AvaI                               SphI



       @
   ATC.TAG.AGG.GCC.CGG.ATC.CCT.CGA.GGT.CGA.CGA.ATT.CGA.GCT.CGG.
    XbaI    ApaI    BamHI   XhoI    AccI    EcoRI   SacI    SfiI
                            AvaI    SalI                   


                                T3 promoter
                        |<-----------------------
   CCG.ACT.TGG.CCT.TCC.C|TT.TAG.TGA.GGG.TTA.ATA.A 3'
                            @   @        @   @




@: Termination codon.
SD: Shine-Dalgarno.
*1: Metal chelating affinity tail.
*2a: First part of the enterokinase site.
*2b: Completing part of the enterokinase site.
^: Cleavage site of the enterokinase.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglI, NaeI and NdeI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr N. Mertens(1)(2) and Prof. Dr E. Remaut(1)(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related plasmid reference: Mertens et al., Biotechnology 13 (1995), 175-179 [PMID: 9634760]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061(λ)
Host reference: Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
Related host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 28°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search