Last data update: 17 January 2021 04:22 CET
Plasmid name: pBlueBacmsGCA1dexon6 (LMBP 4468)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4468.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Mouse guanylate cyclase 1, soluble, alpha 3 cDNA (Gucy1a3, alfa 1 sGC, sGC-alfa1, sGCA1); fragment V5 epitope; C-terminal Histidine tag (His-tag); C-terminal Escherichia coli lac Z gene (lacZ); 5' fragment with modified 5' end Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment |
Promoter: | Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Insect cells; e.g. Sf9 cells |
Parental clone: | pBlueBac4.5/V5-His-TOPO |
Further information: | The plasmid was constructed by inserting a TaqI amplied PCR fragment, containing the mouse sGCA1 coding sequence without exon 6, in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector. The mouse sGCA1 coding sequence is not in phase with the C-terminal His-tag and V5 epitope. After cotransfection with Bac-N-Blue‚ Linear DNA, the plasmid can be used for mouse sGCA1dexon6 expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection. The 3' AcNPV ORF 1629 fragment recombines and restores the essential ORF 1629 for production of viable, recombinant virus. As compared to the wild type coding sequence, the lacZ fragment shows some modifications at the N-terminus, where nucleotide positions 4 to 25 (ACCATGATTACGGATTCACTGG) are replaced with a shorter sequence (ATAGATC; positions 4 to 10); furthermore, silent mutations are present at position 297 (A-> G) and 558 (T->C). The nucleotide sequence of the mouse sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1. Other name of the plasmid is pBlueBac4.5/V5-msGCAlpha1-exon6. |
EMBL Accession number: | AF297082.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 30/01/2002 |
Sequence detail: | Nucleotide sequence at the 3' end of the sGCA1 insert: msGCA1dexon6 ->| |<- V5 epitope 5'.GGG.GTA.GAT.TAG.TGAGCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCT|GGTAAGCCTATCCC +++ HindIII ->| |<- His-tag ->| TAACCCTCTCCTCGGTCTCGATTCTACG|CGTACCGGT|CATCATCACCATCACCAT|TGACGTCTCTAGCTTGGAGTCGACAA 3' AgeI SalI +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Brouckaert(1) (2). It was constructed by M. Buys(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 TOP10 |
Host reference: | Invitrogen Instruction Manual |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.