LMBP plasmid details

Last data update: 17 January 2021 04:22 CET

Plasmid name: pBlueBachsGCA1 (LMBP 4487)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: (View with Genome Compiler)
analysis results


Cloned DNA: Human guanylate cyclase 1 soluble subunit alpha 1 cDNA (GUCY1A1, GC-SA3, GUC1A3, GUCY1A3, sGCA1, GeneID 2982)
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Escherichia coli lac Z gene (lacZ); 5' fragment with modified 5' end
Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment
Promoter: Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH)
Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL)
binding site:
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells; e.g. Sf9 cells
Parental clone: pBlueBac4.5/V5-His-TOPO
Further information: The plasmid was constructed by inserting a TaqI amplified PCR fragment, containing the human sGCA1 coding sequence, in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector.
The human sGCA1 coding sequence is not in phase with the C-terminal His-tag and V5 epitope.
After cotransfection with Bac-N-Blue‚ Linear DNA, the plasmid can be used for human sGCA1 expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection. The 3' AcNPV ORF 1629 fragment recombines and restores the essential ORF 1629 for production of viable, recombinant virus.
As compared to the wild type coding sequence, the lacZ fragment shows some modifications at the N-terminus, where nucleotide positions 4 to 25 (ACCATGATTACGGATTCACTGG) are replaced with a shorter sequence (ATAGATC; positions 4 to 10); furthermore, silent mutations are present at position 297 (A-> G) and 558 (T->C).
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727224.1.
The nucleotide sequence of the human sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U58855.1.
Other name of the plasmid is pBlueBac4.5/V5-hsGCAlpha1.
EMBL Accession number: U58855.1, view at EMBL, GenBank, DDBJ
LT727224.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 30/01/2002
Sequence detail:
Nucleotide sequence at the 3' end of the human sGCA1 insert:

       hsGCA1 ----------->                             ---------- V5 epitope
                   690 +++                 HindIII

-------------------->         ---- His-tag ---->   
                        AgeI                                      SalI

+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AvaI, HindIII and NcoI/XbaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Brouckaert(1) (2). It was constructed by M. Buys(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 TOP10
Host reference: Invitrogen Instruction Manual
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search