Last data update: 17 January 2021 04:22 CET
Plasmid name: pBBR-exoS (LMBP 5157)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5157.gb
(View with Genome Compiler) p5157.txt p5157.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Pseudomonas aeruginosa PAO1 exoenzyme S cDNA (exoS) Histidine tag (His-tag); C-terminal Bordetella bronchiseptica S87 plasmid pBBR1 mobilisation gene (mob); with modified 3' end |
Promoter: | Pseudomonas aeruginosa PAO1 exoenzyme S promoter (exoS) Escherichia coli lac operon promoter Phage T3 promoter Phage T7 gene 10 promoter (T7g10) |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Chloramphenicol (cam) |
Replicon: | Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon |
Host range: | Escherichia coli Gram-negative bacterial strains |
Parental clone: | pBBR1MCS |
Further information: | The plasmid was constructed by inserting a 1605 bp XbaI-BamHI amplicon, containing the P. aeruginosa exoS promoter and the exoS cds in frame with the C-terminal His-tag, into the XbaI-BamHI opened pBBR1MCS vector. This is a bacterial expression vector for P. aeruginosa ExoS under control of the endogenous exoS promoter. ExoS is a Type III secretion system (T3SS) effector protein. Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or strains expressing the tra genes of RK2/RP4). The nucleotide sequence of the pBBR1MCS vector corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1. The nucleotide sequence of the wt mob gene corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1 and with the EMBL nucleotide sequence Database accession number X66730.1. The nucleotide sequence of the exoS cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AE004091.2. Other name of the plasmid is pBBR1MCS-promotorExoS GAP+/ADPRT+. |
EMBL Accession number: | U02374.1, view at EMBL, GenBank, DDBJ X66730.1, view at EMBL, GenBank, DDBJ AE004091.2, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 13/08/2008 |
Sequence detail: | Primers used to amplify the wild-type exoS insert: forward: 5' GCGTCTAGATGGTGGATGGCGGCGCGGTAGAGTGGATTC 3' XbaI 453 450 445 reverse: 5' GCGGGATCC.TCA.GTG.ATG.GTG.ATG.GTG.ATG.GGC.CAG.ATC.AAG.GCC.GCG.CAT.CCT.CAG.G 3' BamHI +++ <------ His-tag ------- <--------------- exoS ---------------- +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/XbaI, BglI, MlsI/PvuI, NcoI and PstI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by M. Haegman(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Galle et al., J. Cell. Mol. Med. 12 (2008), 1767-1776 [PMID: 18081695] |
Related plasmid reference: | Antoine et al., Mol. Microbiol. 6 (1992), 1785-1799 [PMID: 1321324] Kovach et al., BioTechniques 16 (1994), 800-802 [PMID: 8068328] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + chloramphenicol (25 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.