GREAT AT SMALL THINGS

0

LMBP plasmid details

Last data update: 29 October 2020 04:15 CET

Plasmid name: p1168hIL6m3AP1-luc+ (LMBP 4492)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4492.gb (View with Genome Compiler)
p4492.txt
p4492.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Photinus pyralis (firefly) luciferase gene (LUC); mutated coding region (LUCm; luc(+))
Promoter: Human interleukin 6 promoter (IL6); mutated sequence
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Mammalian cells
Parental clone: pGL3-Basic; pBLHIL6CAT
Further information: The plasmid was constructed by ligating the 2338 bp AseI (VspI)/XhoI fragment of pBLHIL6CAT, containing the human IL6 promoter, to the 3293 bp AseI (VspI)/XhoI fragment of pGL3-Basic.
The 3' binding site for the activator protein 1 (AP1) transcription factor of the human IL6 promoter was abolished by site-directed mutagenesis, creating a unique EcoRI site.
Mammalian cells can be directly transfected transiently with the plasmid. However, promoter regulation can be better evaluated when the mammalian cells are stably transfected.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727228.1.
The nucleotide sequence of the genomic human IL6 DNA corresponds with the EMBL Nucleotide Sequence Database accession number AC073072.11, except for the C nucleotide at promoter position -174 (polymorphism mutant) which was changed into a G nucleotide (wild type) and for the abolished 3AP1 site.
Other name of the plasmid is p1168hu.IL6P-luc+3AP1(EcoRI)mut.
EMBL Accession number: AC073072.11, view at EMBL, GenBank, DDBJ
LT727228.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 30/04/2004
Sequence detail:
Mutator oligonucleotide used:

           3'AP1 mutant        
5' GGGATTTTCCCAGAATTCTCAATATTAG 3'
               EcoRI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Eco47III/XbaI, EcoRI, NcoI/SalI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr W. Vanden Berghe(1) and Prof. Dr G. Haegeman(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Vanden Berghe et al., J. Biol. Chem. 273 (1998), 3285-3290 [PMID: 9452444]
Related plasmid reference: Vanden Berghe et al., J. Biol. Chem. 274 (1999), 32091-32098 [PMID: 10542243]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search