Last data update: 05 March 2021 04:23 CET
Plasmid name: YDp-W (LMBP 3357)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
ydp-w.gb
(View with Genome Compiler) ydp-w.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: | Saccharomyces cerevisiae tryptophan 1 disruption cassette (TRP1) |
Promoter: | Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) TRP1; auxotrophic |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Saccharomyces cerevisiae; trp1(-), integrative |
Parental clone: | pUC9HStop; pJH-W1 |
Further information: | The plasmid was constructed by inserting a 821 bp EcoRI (filled in with Klenow DNA polymerase) - PstI (blunted with T4 DNA polymerase) fragment of pJH-W1, containing the S. cerevisiae TRP1 auxotrophically selectable marker gene, into the unique HindIII site (filled in with Klenow DNA polymerase) of pUC9HStop, a pUC9 derivative differing in the sequence of the multicloning site. This is an integrative yeast plasmid designed for gene disruption purposes. The disruption cassette consists of the TRP1 gene, flanked by termination codons in all three reading frames and restriction sites. The termination codons prevent read-through from the remaining sequences of disrupted genes and those of the selectable disrupting fragment; in this way, possible artefactual phenotypic effects caused by fortuitous hybrid proteins are avoided. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequences at the junctions were experimentally verified by Dr G. Berben prior to deposit at BCCM/GeneCorner. The sequence at the PstI-HindIII fusion did not completely correspond with the theoretically expected sequence. |
EMBL Accession number: | - |
Latest sequence update: | 12/10/1995 |
Sequence detail: | Nucleotide sequence at the termination modules flanking the TRP1 insert: HindIII/EcoRI fusion stop module | ----------> |--> TRP1 DNA 5' GAATTCCCGGGGATCCGGTGATTGATTGAGCAAGCT|AATTCGGT ... EcoRI BamHI --- --- --- SmaI PstI/HindIII fusion | stop module --> TRP1 DNA| <---------- ... CACTTGCC|CTTGCTCAATCAATCACCGGATCCGTCGACCTGCAGCCAAGCTAGCTT 3' --- --- --- BamHI SalI PstI NheI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaII, BamHI/HindIII, EcoRI/PstI, SmaI and TaqI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr G. Berben(1). (1) Centre de Recherches agronomiques de l' Etat, Station de Chimie et de Physique agricoles, Laboratoire de Microbiologie, Gembloux, Belgium |
Plasmid reference: | Berben et al., Yeast 7 (1991), 475-477 [PMID: 1897313] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1066 |
Host reference: | Casadaban et al., Methods Enzymol. 100 (1983), 293-298 [PMID: 6312261] |
Cultivation medium: | LB-Lennox + ampicillin (50 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | Cultivation conditions: under rotational shaking. |
Other culture collection numbers: | - |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.